eddb.pl

Dariusz W. Szczepanik1,2

1  Department of Theoretical Chemistry, Jagiellonian University
    Faculty of Chemistry, Gronostajowa 2, 30-387 Krakow, Poland
2  Institute of Computational Chemistry and Catalysis, University of Girona
    C/ Maria Aurèlia Capmany, 69, 17003 Girona, Catalonia, Spain



PL  What is EDDB?

The EDDB method relies on the following decomposition of the one-electron density ED(r):

PL  Features & Capabilities

The EDLB(r) and EDDB(r) functions provide a uniform approach to quantify chemical bonding and resonance, multicenter electron sharing and aromaticity within one theoretical paradigm. There are several important features that set EDDB apart from other aromaticity indices:

At the moment the EDDB method works for one-determinant wavefunctions (HF- and DFT-type) of both closed- and open-shell molecular systems; generalization of the EDDB method for the post-HF wavefunctions is in progress. Its current implementation involves the Hilbert-space partitioning within the representation of natural atomic orbitals (NAO), which is widely available for most of the popular quantum-chemistry packages through NBO and JaNPA interfaces.

PL  Examples


Global resonance effects in DNA fragment AATTCGTATAAAAACTAGAC visualized by EDDBg(r):

PL  Download







Last update:    2018-01-09