eddb.pl

Dariusz W. Szczepanik1,2

1  Department of Theoretical Chemistry, Jagiellonian University
    Faculty of Chemistry, Gronostajowa 2, 30-387 Krakow, Poland
2  Institute of Computational Chemistry and Catalysis, University of Girona
    C/ Maria Aurèlia Capmany, 69, 17003 Girona, Catalonia, Spain



PL  What is EDDB?

The Electron Density of Delocalized Bonds (EDDB) enables one to visualize and quantify chemical resonance, multicenter bonding and aromaticity in a wide range of chemical species. It relies on the following decomposition scheme:


The RunEDDB program is an R-based implementation of the EDDB method, and its current version (19.02b) works with Gaussian formatted checkpoint files for closed- and open-shell systems at the HF/DFT theory level.

PL  Examples



Global resonance effects in DNA fragment AATTCGTATAAAAACTAGAC visualized by EDDBg(r):

PL  Download







Last update:    2018-01-09